reading

Cover
Title Page
List of Contributors
Preface
About the Editor
Part I: Overview of Protein Moonlighting
1. 1 What is Protein Moonlighting and Why is it Important?
  1. 1.1 What is Protein Moonlighting?
  2. 1.2 Why is Moonlighting Important?
  3. 1.3 Current questions
  4. 1.4 Conclusions
  5. References
2. 2 Exploring Structure–Function Relationships in Moonlighting Proteins
  1. 2.1 Introduction
  2. 2.2 Multiple Facets of Protein Function
  3. 2.3 The Protein Structure–Function Paradigm
  4. 2.4 Computational Approaches for Identifying Moonlighting Proteins
  5. 2.5 Classification of Moonlighting Proteins
  6. 2.6 Conclusions
  7. References
Part II: Proteins Moonlighting in Prokarya
1. 3 Overview of Protein Moonlighting in Bacterial Virulence
  1. 3.1 Introduction
  2. 3.2 The Meaning of Bacterial Virulence and Virulence Factors
  3. 3.3 Affinity as a Measure of the Biological Importance of Proteins
  4. 3.4 Moonlighting Bacterial Virulence Proteins
  5. 3.5 Bacterial Moonlighting Proteins Conclusively Shown to be Virulence Factors
  6. 3.6 Eukaryotic Moonlighting Proteins That Aid in Bacterial Virulence
  7. 3.7 Conclusions
  8. References
2. 4 Moonlighting Proteins as Cross‐Reactive Auto‐Antigens
  1. 4.1 Autoimmunity and Conservation
  2. 4.2 Immunogenicity of Conserved Proteins
  3. 4.3 HSP Co‐induction, Food, Microbiota, and T‐cell Regulation
  4. 4.4 The Contribution of Moonlighting Virulence Factors to Immunological Tolerance
  5. References
Part III: Proteins Moonlighting in Bacterial Virulence
1. 3.1 Chaperonins: A Family of Proteins with Widespread Virulence Properties
  1. 5 Chaperonin 60 Paralogs in Mycobacterium tuberculosis and Tubercle Formation
    1. 5.1 Introduction
    2. 5.2 Tuberculosis and the Tuberculoid Granuloma
    3. 5.3 Mycobacterial Factors Responsible for Granuloma Formation
    4. 5.4 Mycobacterium tuberculosis Chaperonin 60 Proteins, Macrophage Function, and Granuloma Formation
    5. 5.5 Conclusions
    6. References
  2. 6 Legionella pneumophila Chaperonin 60, an Extra‐ and Intra‐Cellular Moonlighting Virulence‐Related Factor
    1. 6.1 Background
    2. 6.2 HtpB is an Essential Chaperonin with Protein‐folding Activity
    3. 6.3 Experimental Approaches to Elucidate the Functional Mechanisms of HtpB
    4. 6.4 Secretion Mechanisms Potentially Responsible for Transporting HtpB to Extracytoplasmic Locations
    5. 6.5 Identifying Functionally Important Amino Acid Positions in HtpB
    6. 6.6 Functional Evolution of HtpB
    7. 6.7 Concluding Remarks
    8. References
2. 3.2 Peptidylprolyl Isomerases, Bacterial Virulence, and Targets for Therapy
  1. 7 An Overview of Peptidylprolyl Isomerases (PPIs) in Bacterial Virulence
    1. 7.1 Introduction
    2. 7.2 Proline and PPIs
    3. 7.3 Host PPIs and Responses to Bacteria and Bacterial Toxins
    4. 7.4 Bacterial PPIs as Virulence Factors
    5. 7.5 Other Bacterial PPIs Involved in Virulence
    6. 7.6 Conclusions
    7. References
3. 3.3 Glyceraldehyde 3‐Phosphate Dehydrogenase (GAPDH): A Multifunctional Virulence Factor
  1. 8 GAPDH: A Multifunctional Moonlighting Protein in Eukaryotes and Prokaryotes
    1. 8.1 Introduction
    2. 8.2 GAPDH Membrane Function and Bacterial Virulence
    3. 8.3 Role of Nitric Oxide in GAPDH Bacterial Virulence
    4. 8.4 GAPDH Control of Gene Expression and Bacterial Virulence
    5. 8.5 Discussion
    6. Acknowledgements
    7. References
  2. 9 Streptococcus pyogenes GAPDH: A Cell‐Surface Major Virulence Determinant
    1. 9.1 Introduction and Early Discovery
    2. 9.2 GAS GAPDH: A Major Surface Protein with Multiple Binding Activities
    3. 9.3 AutoADP‐Ribosylation of SDH and Other Post‐Translational Modifications
    4. 9.4 Implications of the Binding of SDH to Mammalian Proteins for Cell Signaling and Virulence Mechanisms
    5. 9.5 Surface Export of SDH/GAPDH: A Cause or Effect?
    6. 9.6 SDH: The GAS Virulence Factor‐Regulating Virulence Factor
    7. 9.7 Concluding Remarks and Future Perspectives
    8. References
  3. 10 Group B Streptococcus GAPDH and Immune Evasion
    1. 10.1 The Bacterium GBS
    2. 10.2 Neonates are More Susceptible to GBS Infection than Adults
    3. 10.3 IL‐10 Production Facilitates Bacterial Infection
    4. 10.4 GBS Glyceraldehyde‐3‐Phosphate Dehydrogenase Induces IL‐10 Production
    5. 10.5 Summary
    6. References
  4. 11 Mycobacterium tuberculosis Cell‐Surface GAPDH Functions as a Transferrin Receptor
    1. 11.1 Introduction
    2. 11.2 Iron Acquisition by Bacteria
    3. 11.3 Iron Acquisition by Intracellular Pathogens
    4. 11.4 Iron Acquisition by M. tb
    5. 11.5 Glyceraldehyde‐3‐Phosphate Dehydrogenase (GAPDH)
    6. 11.6 Macrophage GAPDH and Iron Uptake
    7. 11.7 Mycobacterial GAPDH and Iron Uptake
    8. 11.8 Conclusions and Future Perspectives
    9. Acknowledgements
    10. References
  5. 12 GAPDH and Probiotic Organisms
    1. 12.1 Introduction
    2. 12.2 Probiotics and Safety
    3. 12.3 Potential Risk of Probiotics
    4. 12.4 Plasminogen Binding and Enhancement of its Activation
    5. 12.5 GAPDH as an Adhesin
    6. 12.6 Binding Regions
    7. 12.7 Mechanisms of Secretion and Surface Localization
    8. 12.8 Other Functions
    9. 12.9 Conclusion
    10. References
4. 3.4 Cell‐Surface Enolase: A Complex Virulence Factor
  1. 13 Impact of Streptococcal Enolase in Virulence
    1. 13.1 Introduction
    2. 13.2 General Characteristics
    3. 13.3 Expression and Surface Exposition of Enolase
    4. 13.4 Streptococcal Enolase as Adhesion Cofactor
    5. 13.5 Enolase as Pro‐Fibrinolytic Cofactor
    6. 13.6 Streptococcal Enolase as Cariogenic Factor in Dental Disease
    7. 13.7 Conclusion
    8. Acknowledgement
    9. References
  2. 14 Streptococcal Enolase and Immune Evasion
    1. 14.1 Introduction
    2. 14.2 Localization and Crystal Structure
    3. 14.3 Multiple Binding Activities of α‐Enolase
    4. 14.4 Involvement of α‐Enolase in Gene Expression Regulation
    5. 14.5 Role of Anti‐α‐Enolase Antibodies in Host Immunity
    6. 14.6 α‐Enolase as Potential Therapeutic Target
    7. 14.7 Questions Concerning α‐Enolase
    8. References
  3. 15 Borrelia burgdorferi Enolase and Plasminogen Binding
    1. 15.1 Introduction to Lyme Disease
    2. 15.2 Life Cycle
    3. 15.3 Borrelia Virulence Factors
    4. 15.4 Plasminogen Binding by Bacteria
    5. 15.5 B. burgdorferi and Plasminogen Binding
    6. 15.6 Enolase
    7. 15.7 B. burgdorferi Enolase and Plasminogen Binding
    8. 15.8 Concluding Thoughts
    9. Acknowledgements
    10. References
5. 3.5 Other Glycolytic Enzymes Acting as Virulence Factors
  1. 16 Triosephosphate Isomerase from Staphylococcus aureus and Plasminogen Receptors on Microbial Pathogens
    1. 16.1 Introduction
    2. 16.2 Identification of Triosephosphate Isomerase on S. aureus as a Molecule that Binds to the Pathogenic Yeast C. neoformans
    3. 16.3 Binding of Triosephosphate Isomerase with Human Plasminogen
    4. 16.4 Plasminogen‐Binding Proteins on Trichosporon asahii
    5. 16.5 Plasminogen Receptors on C. neoformans
    6. 16.6 Conclusions
    7. References
  2. 17 Moonlighting Functions of Bacterial Fructose 1,6‐Bisphosphate Aldolases
    1. 17.1 Introduction
    2. 17.2 Fructose 1,6‐bisphosphate Aldolase in Metabolism
    3. 17.3 Surface Localization of Streptococcal Fructose 1,6‐bisphosphate Aldolases
    4. 17.4 Pneumococcal FBA Adhesin Binds Flamingo Cadherin Receptor
    5. 17.5 FBA is Required for Optimal Meningococcal Adhesion to Human Cells
    6. 17.6 Mycobacterium tuberculosis FBA Binds Human Plasminogen
    7. 17.7 Other Examples of FBAs with Possible Roles in Pathogenesis
    8. 17.8 Conclusions
    9. References
6. 3.6 Other Metabolic Enzymes Functioning in Bacterial Virulence
  1. 18 Pyruvate Dehydrogenase Subunit B and Plasminogen Binding in Mycoplasma
    1. 18.1 Introduction
    2. 18.2 Binding of Human Plasminogen to M. pneumoniae
    3. 18.3 Localization of PDHB on the Surface of M. pneumoniae Cells
    4. 18.4 Conclusions
    5. References
7. 3.7 Miscellaneous Bacterial Moonlighting Virulence Proteins
  1. 19 Unexpected Interactions of Leptospiral Ef‐Tu and Enolase
    1. 19.1 Leptospira –Host Interactions
    2. 19.2 Leptospira Ef‐Tu
    3. 19.3 Leptospira Enolase
    4. 19.4 Conclusions
    5. References
  2. 20 Mycobacterium tuberculosis Antigen 85 Family Proteins
    1. 20.1 Introduction
    2. 20.2 Identification of Antigen 85
    3. 20.3 Antigen 85 Family Proteins: Mycolyl Transferases
    4. 20.4 Antigen 85 Family Proteins: Matrix‐Binding Adhesins
    5. 20.5 Conclusion
    6. Acknowledgement
    7. References
8. 3.8 Bacterial Moonlighting Proteins that Function as Cytokine Binders/Receptors
  1. 21 Miscellaneous IL‐1β‐Binding Proteins of Aggregatibacter actinomycetemcomitans
    1. 21.1 Introduction
    2. 21.2 A. actinomycetemcomitans Biofilms Sequester IL‐1β
    3. 21.3 A. actinomycetemcomitans Cells Take in IL‐1β
    4. 21.4 The Potential Effects of IL‐1β on A. actinomycetemcomitans
    5. 21.5 Conclusions
    6. References
9. 3.9 Moonlighting Outside of the Box
  1. 22 Bacteriophage Moonlighting Proteins in the Control of Bacterial Pathogenicity
    1. 22.1 Introduction
    2. 22.2 Bacteriophage T4 I‐TevI Homing Endonuclease Functions as a Transcriptional Autorepressor
    3. 22.3 Capsid Psu Protein of Bacteriophage P4 Functions as a Rho Transcription Antiterminator
    4. 22.4 Bacteriophage Lytic Enzymes Moonlight as Structural Proteins
    5. 22.5 Moonlighting Bacteriophage Proteins De‐Repressing Phage‐Inducible Chromosomal Islands
    6. 22.6 dUTPase, a Metabolic Enzyme with a Moonlighting Signalling Role
    7. 22.7 Escherichia coli Thioredoxin Protein Moonlights with T7 DNA Polymerase for Enhanced T7 DNA Replication
    8. 22.8 Discussion
    9. References
  2. 23 Viral Entry Glycoproteins and Viral Immune Evasion
    1. 23.1 Introduction
    2. 23.2 Enveloped Viral Entry
    3. 23.3 Moonlighting Activities of Viral Entry Glycoproteins
    4. 23.4 Viral Entry Proteins Moonlighting as Saboteurs of Cellular Pathways
    5. 23.5 Conclusions
    6. References
10. Index
11. End User License Agreement

List of Tables

Chapter 02
1. Table 2.1 Proteins having distinct sites for different functions in the same domain.
2. Table 2.2 Proteins having distinct sites for different functions in different domains.
3. Table 2.3 Proteins using the same residues for different functions.
4. Table 2.4 Proteins using different residues in the same/overlapping site for different functions.
5. Table 2.5 Proteins using different folds for different functions.
Chapter 03
1. Table 3.1 Binding affinities of moonlighting proteins to various protein ligands.
2. Table 3.2 Binding affinities of moonlighting proteins to plasmino(gen).
3. Table 3.3 The distribution of bacterial moonlighting proteins into functional groups. Proteins in bold are those produced both by bacteria and eukaryotes.
4. Table 3.4 Some bacterial moonlighting proteins with (some of their) multiple moonlighting functions. Biological actions are not in any particular order, and not all the biological functions of these proteins are shown.
5. Table 3.5 Bacterial moonlighting proteins acting as bacterial adhesins.
6. Table 3.6 Bacterial moonlighting proteins functioning as evasins.
Chapter 07
1. Table 7.1 Bacteria with cell‐surface Mip‐like PPIs.
Chapter 08
1. Table 8.1 Membrane‐bound bacterial GAPDH as a virulence factor.
2. Table 8.2 GAPDH‐mediated transnitrosylation.
Chapter 09
1. Table 9.1 Post‐translational modifications of SDH and resulting moonlighting functions.
2. Table 9.2 SDH binding to mammalian proteins and resulting moonlighting functions.
3. Table 9.3 SDH‐mediated S. pyogenes virulence gene regulation (Jin et al. 2011).
Chapter 11
1. Table 11.1 Identified M. tb H37Rv transferrin‐binding proteins (Boradia et al. 2014).
Chapter 12
1. Table 12.1 Representative probiotic strains.
2. Table 12.2 Probiotics strains expressing GAPDH on cell surface and its targeting ligands.
Chapter 13
1. Table 13.1 Streptococcus enolases.
2. Table 13.2 Bacterial enolases.
Chapter 18
1. Table 18.1 Described glycolytic enzymes with multifunction in Mycoplasma/Spiroplasma.
2. Table 18.2 Results of reactivity of recombinant protein PDHB with sera (n = 32) of patients with symptoms of community‐acquired pneumonia and confirmed M. pneumoniae‐specific antibodies in comparison with total antigen of M. pneumoniae (ELISA; secondary antibody: anti‐human whole Ig‐HRP).
Chapter 19
1. Table 19.1 Leptospira proteins exhibiting moonlighting activities.
Chapter 23
1. Table 23.1 Viral moonlighting proteins and their interactions with the complement system.
2. Table 23.2 Role of various viral GPs in antibody evasion.
3. Table 23.3 Moonlighting activities of the HIV‐1 gp41 viral entry glycoprotein.

List of Illustrations

Chapter 02
1. Figure 2.1 Function annotations for the mouse protein, glucose‐6‐phosphate isomerase (Uniprot Accession no. P06745) from the Enzyme Commision (EC) number system and Gene Ontology.
2. Figure 2.2 From protein structure to function.
3. Figure 2.3 α‐Enolase. (a) Single chain of Enolase showing the enzyme active site in blue and the plasminogen‐binding site in red. (b) Enolase monomer displayed as surface. Different domains are colored in gray and orange (PDB:1W6T).
4. Figure 2.4 Albaflavenone monooxygenase. The monooxygenase and terpene synthase active sites are shown in blue and red respectively in the (a) cartoon and (b) surface representation of Albaflavenone monooxygenase (PDB: 3EL3).
5. Figure 2.5 Human MAPK1/ERK2. The MAPK1 active site is shown in blue and the DNA‐binding motif is highlighted in red. Different domains are shown in gray and orange (PDB:4G6N).
6. Figure 2.6 Malate synthase. The enzyme active site is shown in blue and the laminin‐ binding site is shown in red. Different domains are shown in different colors (PDB:2GQ3).
7. Figure 2.7 BirA. The catalytic site residues are shown in blue while the H‐T‐H motif involved in binding DNA (moonlighting function) is shown in red. Different domains are shown in different colors (PDB:1BIB).
8. Figure 2.8 Human MRDI. The active site residues are shown in blue while the residues implicated in controlling invasion (moonlighting function) is shown in red. Different domains are shown in different colors (PDB:4LDQ).
9. Figure 2.9 GAPDH. The catalytic site residue Cys149 (shown in red) is the residue known to be involved for both the canonical and moonlighting functions of E. coli GAPDH. The other catalytic residue His179 is shown in blue (PDB:1DC5).
10. Figure 2.10 Leukotriene A4 hydrolase. The LTA4 catalytic site residues Glu296 and Tyr383 are shown in blue. The catalytic site residue Glu271, involved in two separate functions in two different catalytic reactions is shown in red (PDB:2R59).
11. Figure 2.11 Phosphoglucose isomerase (PGI). Catalytic residues are shown as red sticks. Inhibition of enzymatic and AMF functions of PGI by the PGI inhibitor and mutational analysis of the catalytic residues have indicated overlapping regions of both functions in the human PGI (PDB:1IAT).
12. Figure 2.12 Aldolase. The enzyme active site is shown in blue and the actin‐binding site is shown in red (PDB:2PC4).
13. Figure 2.13 RfaH The Rfah CTD is colored in orange. In the closed form of RfaH (a), the CTD (α‐helix form) and NTD tightly interacts and works as a transcription factor (PDB:2OUG). The subsequent (or simultaneous) refolding of the CTD into a (b) β‐barrel transforms RfaH into a translation factor (PDB:2LCL).
14. Figure 2.14 Structural diversity v. functional diversity of CATH domain superfamilies represented in the moonlighting proteins studied in this chapter. Structural diversity is represented by the number of structural clusters (domains clustered at 5Å RMSD) in the superfamilies and the functional diversity is represented by the number of functional families identified in the superfamily.
Chapter 03
1. Figure 3.1 A schematic diagram showing the dynamic “timeline” of a typical bacterial infection and the requirements for the major virulence factors in the process.
Chapter 05
1. Figure 5.1 A cartoon view of the tuberculoid granuloma with cellular compositions deemed to be associated with bactericidal action or favoring bacterial persistence.
Chapter 06
1. Figure 6.1 Signaling cascades used by HtpB to trigger pseudohyphal growth in S. cerevisiae. Diagram showing the natural signaling pathways leading to expression of genes (FLO11 being a main one) required for pseudohyphae formation. HtpB acts at the level of, or upstream from Ras2, signaling in a nitrogen‐ and glucose‐independent manner. Our data indicate that the Ste‐kinase and cAMP/PKA pathways are both critical to, and the only two pathways involved in, the induction of pseudohyphal growth by HtpB. Factors from top to bottom: Gpr1: G protein‐coupled receptor/transmembrane sensor; Gpa2: Gα subunit; Msb2: sensor/receptor; Sho1 and Opy2: sensors/G protein adaptors; Cdc24: guanine nucleotide exchange factor for Cdc42; Ras2: G protein global regulator; Cyr1: adenylate cyclase; Cdc42: Rho GTPase; Bcy1: regulatory subunit of the PKA complex; Tpk1/2/3: protein kinases A; Yak1: dual‐specificity tyrosine‐regulated kinase; Ste20: p21‐activated kinase; Ste11: MAPKKK; Ste50: adaptor/scaffold protein; Ste7: MAPKK; Kss1: MAPK of the filamentous growth pathway; Fus3: MAPK of the mating pathway; Flo8/Sok2/Ste12/Tec1/Phd1: transcription factors; FLO11: main hub of signal transduction. Notes: Upon binding cAMP, Bcy1 releases the three PKAs Tpk1/2/3, which then become active. Yak1 is active when non‐phosphorylated and it mediates low expression of Flo11 (thin arrows). Phosphorylation of Yak1 by Tpk1 inactivates it (gray arrow with circular head). Ste50 is known to specifically bind Ste11, but it could serve as the scaffold for the MAP kinase module (Ste11 + Ste7 + Kss1). Unregulated filamentous growth is detrimental for mating, so activated Fus3 acts as a repressor of Tec1 + Ste12 transcription factors (gray arrow with circular head). Active transcription from the FLO11 promoter is depicted by the curved white arrow on the left of the FLO11 gene.
2. Figure 6.2 HtpB‐induced filamentation and agar invasion (but not elongation and unipolar budding) requires the Ste‐kinase pathway in S. cerevisiae. Light micrographs of microcolonies of S. cerevisiae strain W303‐1b with the indicated deletions in genes encoding members of the Ste‐kinase (MAP‐kinase) pathway, and either containing pPP389::htpB (Nasrallah et al. 2011b) for expression of HtpB (+HtpB), or the empty vector control pPP389 (VC). All deletion mutants were grown on inducing galactose solid medium, as HtpB expression is controlled by a galactose‐inducible promoter. The ste mutants were created by allelic replacement with restriction fragments from plasmids pEL45 (ste20Δ::URA3) (Leberer et al. 1992), pSL1311 (ste11Δ::URA3), pSL1077 (ste7Δ::URA3), and pSL1094 (ste12Δ::URA3) (Stevenson et al. 1992). The restriction enzymes used were: pEL45 XbaI/SalI, pSL1077 KpnI/ClaI, pSL1094 BamHI/XhoI, and pSL1311 SstI/SphI. The restriction fragments were transformed as linear DNA into strain W303‐1b, and colonies of deletion mutants were then selected on solid medium lacking uracil. Bars represent 12.5 µm.
3. Figure 6.3 HtpB induces cell elongation and unipolar budding in S. cerevisiae strain W303‐1b carrying the dominant negative CDC42^Ala‐118 allele. Light micrographs of microcolonies (grown on inducing galactose solid medium) of S. cerevisiae strain W303‐1b bearing: (a) plasmid YCp(CDC42^Ala‐118) for expression of Cdc42p‐Ala118 (Ziman et al. 1991); or (b, c) plasmids pLM86 (Nasrallah et al. 2011b) and YCp(CDC42^Ala‐118) for simultaneous expression of HtpB and Cdc42p‐Ala118 (+HtpB in the presence of YCp(CDC42^Ala‐118)). Plasmid YCp was generously donated by H.‐U. Mösch (Philipps University, Germany). Yeast cells carrying the CDC42^Ala‐118 allele grew large but did not elongate (a). Some large elongated cells are marked with the white arrow in (b), and a chain of elongated cells derived from a single large round cell is marked by the arrowheads in (c). Bars represent 10 µm in all panels.
4. Figure 6.4 HtpB‐induced filamentation and agar invasion (but not elongation and unipolar budding) also requires the cAMP/PKA signaling pathway. Light micrographs of microcolonies of haploid cells of S. cerevisiae strain BY4741 (MATa flo8::kan^r his3‐11 leu2‐3,112 met15 ura3‐52), which is a flo8Δ derivative of strain S288C (Brachmann et al. 1998). Strain BY4741 was either bearing: (a) plasmid pLM87 for expression of HtpB (Nasrallah et al. 2011b); (b) plasmid pHL135 for expression of Flo8p (Source: Liu et al. 1996); or (c) both plasmids pLM87 and pHL135 (HtpB and Flo8p). The elongated cells shown in (a) budded in a unipolar manner, but were not agar‐invasive. The FLO8‐complemented cells shown in (b) are aggregated and did not elongate or penetrate the agar. The cells shown in (c) had penetrated the agar (they were hyper‐invasive). Bars represent 10 µm.
5. Figure 6.5 HtpB‐induced pseudohyphal development in S. cerevisiae is dependent on Ras2p. Light micrographs of microcolonies grown on inducing galactose solid medium of a ras2Δ mutant strain (W303‐1b ras2 deletion mutant) bearing the following plasmids: (a) pPP389::htpB (for expression of HtpB; Nasrallah et al. 2011b); (b) pRS313::RAS2 (for expression of Ras2p) plus empty vector pPP389; and (c) pPP389::htpB and pRS313::RAS2 (HtpB and Ras2p). To create the ras2Δ mutant, RAS2 in strain W303‐1b was replaced with the allele ras2::URA3 cut with EcoRI/HindIII from plasmid pras2::URA3 (Kataoka et al. 1984) and transformed as linear DNA. Colonies of ras2Δ mutant cells were selected on solid medium lacking uracil. For genetic complementation, RAS2 was amplified by PCR from strain W303‐1b using primers RAS2full‐F (GTGGCCGTATCAATGGATC) and RAS2full‐R (GGGAAAGAGAAGCTTGTTATTC). The 1967 bp PCR amplification product was digested with XbaI, and cloned into the XbaI and EcoRV sites of the low‐copy number yeast plasmid pRS313 (Sikorski and Hieter 1989) to generate pRS313::RAS2. Note that complementation of ras2Δ cells with wild‐type RAS2 alone did not result in formation of pseudohyphae (b). Bars represent 12.5 µm.
6. Figure 6.6 A Cpn60‐specific secretion mechanism exists in B. pertussis and is induced by the BvgAS two‐component regulatory system. Electron micrographs of ultrathin sections of specimens fixed with 4% freshly depolymerized paraformaldehyde, and subjected to immunogold labeling using a rabbit polyclonal antibody (Chong et al. 2009) that recognizes Cpn60, and a secondary goat anti‐rabbit gold conjugate (Sigma Immunochemicals). A wild‐type B. pertussis parent strain (Bp388 (wt)), a mutant with a defective Ptl type IV secretion system (Ptl –), and a mutant with a non‐functional BvgAS two‐component regulatory system (Bvg –) are shown. For size reference, the gold spheres that indicate the localization of Cpn60 epitopes are 10 nm in diameter.
7. Figure 6.7 Phylogenetic relationships between 48 chaperonins (belonging to 35 bacterial species) known to have moonlighting functions and (or) extra‐cytoplasmic locations. (a) Diagram of an unrooted maximum likelihood phylogenetic tree of the 48 chaperonins. Colors indicate phylum as per legend. Asterisk marks the highly divergent Cpn60.2 and Cpn60.3 of Chlamydia trachomatis and Chlamydophila pneumoniae, whereas the black arrowhead shows the positions of the Cpn60.1 of these two chlamydiales, which are more closely related to the Cpn60 of Borrelia burgdorferi, Porphyromonas gingivalis, and Leptospira interrogans (black branches between the two purple triangles). The open triangle marks the group formed by the three Cpn60s of Mycoplasma gallisepticum, Mycoplasma genitalium, and Mycoplasma pneumoniae, whereas the pound sign marks the position of the Mycoplasma penetrans Cpn60, which closely groups with the Helicobacter pylori’s Cpn60. Branch lengths are proportional to the number of amino acid substitutions per site (scale shown at the bottom of the diagram). (b) Diagram of part of the rooted tree of the same 48 chaperonins shown in (a). The part shown would be equivalent to the central part of the Proteobacteria branch (red bubble) depicted in (a), and includes HtpB (marked with the black arrow) and its closest moonlighting Cpn60s from the intracellular pathogens Piscirickettsia salmonis and Francisella tularensis. The tip labels include the amino acid sequence identification number (Gis for the Pfam database) followed by the bacterial taxonomic name. Branch lengths are proportional to the number of substitutions per site (scale given at the top of the panel). Bootstrap values (%) based on 100 replications are given for every branch.
Chapter 08
1. Figure 8.1 Functional diversity of GAPDH.
2. Figure 8.2 Membrane‐associated GAPDH: structure and function.
3. Figure 8.3 GAPDH and nitric oxide: multipotential effects.
4. Figure 8.4 GAPDH and gene regulation.
5. Figure 8.5 Mechanisms of genomic potentiation.
Chapter 09
1. Figure 9.1 Schematic diagram showing the role of SDH in the S. pyogenes pathogenesis. (a) Various stages of S. pyogenes infection. (b) During infection, as a successful pathogen S. pyogenes adheres to and invades host cells. Subsequently, it hides and proliferates within the host tissues by evading host innate immune responses and maintains its abundance in a local microenvironment. S. pyogenes also causes apoptosis of host cells. In all these different stages of the infection, SDH participates in almost all stages by binding through different receptor ligands as illustrated. (c) The SDH surface export is also important to maintain GAS virulence as, by retaining SDH within cytoplasm, 128 genes, including 25 major virulence genes, are downregulated. SDH is therefore a quintessential important virulence regulator. The surface export of the cytoplasmic SDH and its role in the S. pyogenes virulence regulation may be mediated via several post‐translational modifications including reported phosphorylation, ADP‐ribosylation, S‐guanylation, and ubiquitination. The mechanism underlying this possible and predicted regulation is however unknown.
Chapter 10
1. Figure 10.1 Group B Streptococcus GAPDH modulates the neonatal inflammatory response. (a) GBS cocci growing in chains may spontaneously lyse (dashed red cocci) and the released cytosolic GAPDH (green dot) can then re‐associate with living bacteria. Free or GBS‐bound GAPDH can interact with (b) B cells or with (c) macrophages. Upon interaction with B cells, GAPDH (d) triggers IL‐10 production and (e) impairs neutrophil recruitment. (f) GAPDH can also interact with macrophages to induce their apoptosis.
Chapter 11
1. Figure 11.1 M. tuberculosis expresses cell‐surface transferrin‐binding proteins. (a) FACS analysis indicates specific binding of Tf‐Alexa647 which is competitively inhibited in the presence of 200X unlabeled transferrin. (b)Transferrin conjugated gold particles localize on the surface of intact M. tb H37Ra. (c) No surface labeling is observed in controls (Streptavidin‐gold conjugate). Scale bar represents 0.2 µm.
2. Figure 11.2 Transferrin and GAPDH co‐localize at the cell surface. (b) Co‐localization of GAPDH and transferrin by immunogold labeling transmission electron microscopy of M. tb H37Ra strain overexpressing GAPDH. GAPDH was detected using 1:100 polyclonal rabbit α‐GAPDH, followed by secondary antibody conjugated with 5 nm gold particles. Cells were simultaneously labeled with transferrin‐20 nm gold conjugate. Inset: magnified image of highlighted area showing co‐localization of GAPDH and transferrin. Arrows indicate 5 nm particles (GAPDH); arrowheads indicate the presence of transferrin‐gold. (a) Cells labeled with an equivalent amount of rabbit pre‐immune sera (controls). Scale bar represents 100 nm.
3. Figure 11.3 Transferrin‐iron uptake is mediated by the internalization of transferrin. Presence of transferrin gold particles within the cytoplasm of M. tb H37Ra cells after incubation at 37°C for 1 hr. Scale bar represents 100 nm.
4. Figure 11.4 Mechanisms for the uptake of transferrin iron and Heme by M. tb. 1, 2. Iron depletion stimulates the recruitment of M. tb GAPDH to the cell surface. 3, 4. Surface GAPDH captures holo‐transferrin and the entire complex is internalized within the bacilli. 5, Iron is released from transferrin; its subsequent fate regarding degradation or recycling out of the bacterium is not known. 6, Carboxymycobactin acquires transferrin iron, which is then delivered to the bacilli via mycobactin. 7, Carboxymycobactin directly utilizes the high affinity importer Irt AB to deliver transferrin iron. 8, Heme utilization by M. tb.
Chapter 12
1. Figure 12.1 (a) A representative structure of human intestinal mucus. A dashed square indicates expression of A‐type blood group antigen. (b) Chemical structure of three kinds of human ABO blood group antigens conjugated‐BSA probes. GalNAc: N‐acetylgalactosamine; Gal: galactose; Fuc: fucose; GlcNAc: N‐acetylglucosamine; NeuAc: N‐acetylneuraminic acid (sialic acid); Ser/Thr: serine or threonine.
2. Figure 12.2 The three‐dimensional structure and amino acid sequences of GAPDH of L. plantarum LA 318. The underline indicates CXXXC motif.
3. Figure 12.3 Overview diagram of GAPDH in probiotics.
Chapter 13
1. Figure 13.1 Scheme of moonlighting functions of streptococcal enolase in four categories: interaction with fibrinolysis; stress response; intracellular activities; and function as adhesion cofactor. Enolase structure
2. Figure 13.2 (a) Electron microscopic co‐localization of enolase and GAPDH on the surface of Streptococcus canis G2 by immune‐gold labeling performed by Manfred Rohde, Helmholtz Center for Infection Research (HZI), Braunschweig. (b) FESEM‐visualization at 50,000× magnification and at 100,000× magnification. Arrows point to protein A gold particle (15 nm) detecting GAPDH and arrow heads mark protein A gold (10 nm) detecting enolase.
Chapter 14
1. Figure 14.1 Multimeric crystal structure of S. pneumoniae and human α‐enolase. S. pneumoniae α‐enolase (PDBID: 1w6t) forms an octamer and the human version (PDBID: 3B97) is a dimer. This figure was produced using Yorodumi (run by PDBj) with Jmol, available at http://pdbj.org/emnavi/viewtop.php.
2. Figure 14.2 Phylogenetic tree of Streptococcus α‐enolase. The tree is calculated and drawn by “Average Distance using BLOSUM62” on Jalview 2.8.2. The amino acid sequences were obtained from each genome referential strains.
3. Figure 14.3 Multiple roles of α‐enolase in Streptococcus. α‐enolase has been shown to play various roles in bacterial cell cytoplasm and on the cell surface, as well as in culture supernatant. In the cytoplasm, α‐enolase functions as a glycolytic enzyme in energy metabolism and is also involved in gene regulation. α‐enolase interrupts the host immune system by binding host factors, such as plasminogen and C4b‐binding protein. α‐enolase is an immunogenic protein and antibodies cross‐react with human enolase. In addition, α‐enolase interacts with neutrophils and induces formation of NETs.
Chapter 15
1. Figure 15.1 Alignment of enolase protein sequences from human (three isoforms), Staphylococcus aureus, Escherichia coli, and B. burgdorferi. Identical amino acids are in red; similar amino acids are in blue font. A consensus line underneath the alignment indicates identity (*) or similarity (.). The box at the top of the alignment indicates a hydrophobic domain thought to play a role in membrane association (Pancholi 2001). The box at the bottom of the alignment indicates the catalytic site of the enzyme. Yellow highlighted text indicates an internal plasminogen‐binding motif (Noguiera et al. 2012). Bold black text indicates cross‐reactive epitopes associated with autoimmunity in cancer (Adamus et al. 1998).
Chapter 16
1. Figure 16.1 Protein–protein and protein–carbohydrate interactions between microbes and human hosts.
Chapter 18
1. Figure 18.1 Binding of human plasminogen to M. pneumoniae. (a) Immunofluorescence of fixed M. pneumoniae cells after incubation with Atto488‐labeled plasminogen (50 µg mL^–1). Antiserum to Triton X‐insoluble proteins detected with TRITC‐labeled secondary antibody is used as control. Bar: 10 µm. (b) Ligand immunoblotting assay using SDS‐PAGE‐separated total proteins of M. pneumoniae incubated with plasminogen (15 µg mL^–1) detected with rabbit anti‐plasminogen.
2. Figure 18.2 (a) Time‐dependent binding of human plasminogen (2.5 µg mL^–1) after incubation with M. pneumoniae cells. (b) Detection of human plasminogen in immunoblotting using rabbit anti‐plasminogen.
3. Figure 18.3 Degradation of human fibrinogen (10 µg mL^–1) in the presence of plasminogen (Plg; 10 µg/mL^–1), recombinant protein PDHB (20 µg mL^–1) and activator human uPA (4 ng mL^–1). Fibrinogen was separated, blotted, and detected by rabbit anti‐fibrinogen.
4. Figure 18.4 Time‐dependent quantitative occurrence of PDHB in membrane and cytosolic fraction of total proteins of M. pneumoniae M129 under different conditions of incubation as measured by ELISA. Dilutions of recombinant protein PDHB of known concentration were used as standard.
5. Figure 18.5 Occurrence of subunit B of PDH complex in membrane and cytosolic fraction of total proteins of mutants B170 (lacking adherence‐related proteins P40 and P90) and Iv22a (lacking main P1 adhesin) in comparison to type strain M129 of M. pneumoniae. Detection of cytosolic enzyme enolase (Eno) was carried out as control.
6. Figure 18.6 ELISA reactivity of total proteins of M. pneumoniae and recombinant protein PDHB (10 µg mL^–1 each) with guinea pig antisera obtained after intranasal (i.n.) infection of animals, after subcutaneous immunization with total antigen (s.c. wM.p.), with fractions of Triton X‐100 insoluble proteins (s.c. TX ins) and cytosolic proteins (s.c. cyt) of M. pneumoniae.
Chapter 20
1. Figure 20.1 An illustrated summary of the multiple roles of Ag85. Ag85 (gray surface) is positioned relative to the mycomembrane (gray mesh) so the trehalose (black surfaces) binding sites are accessible from the membrane surface. The bound locations of host protein domains (white surfaces) are based on experimental models.
Chapter 21
1. Figure 21.1 Amino acid sequence of a novel bacterial interleukin receptor I (BilRI), which is an outer membrane (signal sequence underlined) lipoprotein (lipidation site marked with *). The protein contained a triplicate repetitive 40 amino acid long sequence after the first 50 amino acids (including the signal sequence).
2. Figure 21.2 Clustal O sequence alignment of the A. actinomycetemcomitans BilRI amino acid sequence with three different variants of H. ducreyi fibrinogen binder A (FgbA).
3. Figure 21.3 Viable A. actinomycetemcomitans cells internalize IL‐1β both (a) in biofilm and (b) as planktonic cells. Pre‐grown A. actinomycetemcomitans biofilms were co‐cultured with an organotypic gingival mucosa, and the localization of IL‐1β was investigated using immuno‐electron microscopy. IL‐1β was detected both attached to the inner membrane (IM) and in the outer edges of nucleoids (N).
Chapter 22
1. Figure 22.1 The homing mechanism for mobile group I introns. The endonuclease and flanking introns are transcribed, splicing occurs, and the homing endonuclease is translated as a free‐standing protein. The endonuclease activity will cleave an uninterrupted host gene at the corresponding cleavage site, forming a double‐strand break (DSB) close to the intron insertion site. Repair by homology‐driven strand invasion, recombination, and replication using the intron‐containing allele leads to incorporation of the intron and associated endonuclease into the gene.
2. Figure 22.2 A cartoon depicting the two separate functions of homing endonuclease I‐TevI. (a) This section shows the homing function of I‐TevI in which the helix‐turn‐helix interacts with the AT‐rich section of a homing site, leading to the zinc finger directing the catalytic domain 23–25 nucleotides upstream of the intron integration site (Intron Int Site). The catalytic domain cleaves as the CXXXG site and this cleavage forms the DSB necessary for intron homing and incorporation. (b) This section depicts the autorepressor function of the I‐TevI. In this case the helix‐turn‐helix interacts with an AT‐rich site displaying 15 bp identity to the homing AT‐rich site, but upstream of an operator site. This operator AT‐rich sequence may overlap with the T4 late promotor. Binding of the helix‐turn‐helix to the operator site directs the catalytic domain to interact with a CXXXG site 9 nt closer to the DNA‐binding site. Cleavage at this site is reduced c. 100‐fold compared to at the homing site, and this reduction in catalytic activity silences transcription.
3. Figure 22.3 (a) The crystal structure of the Psu monomer with seven α‐helices and dimerization interface. The N‐terminal, α1, and α2 helices form a tight coiled‐coil structure termed the “CC‐stem,” surrounded by the three C‐terminal helices (α5–α7) known as the CT‐belt. The central region, shown here as the dimerization interface and consisting of helices α3 and α4, forms a knotted structure with another monomer. CC‐stem in cyan, CT‐belt in green and central region in magenta. (b) The dimeric structure shown here is formed when the two Psu monomers “knot,” and this knotted region (as indicated) acts as a hinge allowing the other regions to swing inward and outward. This dimer formation allows Psu to interact with and bind the Rho hexamer. (PDB code: 3RX6). The figure shows the dimer with domain colour differences. (c) A top view of the closed, hexameric structure of Rho bound to RNA (PDB code: 3ICE). The two Psu‐binding regions (PBR1 and PBR2) are indicated by arrows along with the central region containing the RNA.
4. Figure 22.4 (a) A cartoon representation of a Psu dimer (PDB: 3RX6) interacting with a Rho hexamer (PDB:3ICE). The Psu dimer occupies diagonally opposite intersubunit niches of the hexamer, near Rho ATP‐binding sites. This interaction positions the Psu dimer over the central channel of the Rho hexamer, which is predicted to mechanically impede the translocase activity of the Rho. (b) A cartoon showing the action of Psu as a transcription antiterminator. The initial figure shows the Rho hexamer on the nascent RNA of the elongation complex (EC), which will lead to the termination of transcription once Rho disassociates the EC from the RNA and template DNA. The second image represents the antitermination mechanism, in which Psu dimer blocks the central channel of the Rho, preventing the translocation of nascent RNA through the Rho and thus preventing the disassociation of the EC from the RNA and template DNA. The Psu dimers here are depicted by surface representation.
5. Figure 22.5 SaPI induction is mediated by a helper phage‐encoded protein. The helper phage and the SaPI reside stably integrated into the bacteria chromosome due to the activity of their respective encoded master repressors, CI for the phage and Stl for the SaPI. When the SOS response is activated the repressor of the phage CI is degraded, allowing the expression of the lytic genes of the phage and initiating its replication. The interaction of a phage‐encoded protein (Inducer) with the Stl repressor of the SaPI allows the de‐repression of the main SaPI promoters and the activation of the island.
Chapter 23
1. Figure 23.1 Illustration of a typical viral fusion event catalyzed by viral envelope and entry glycoproteins with moonlighting activities.
2. Figure 23.2 Shed, soluble, and virion attached Ebola virus glycoproteins.
3. Figure 23.3 A schematic diagram placing the moonlighting activities of the HIV‐1 gp41 viral entry glycoprotein into a structural context.